Coding

Reflecting on Hayles' book, I have become extremely interested in the notion of technological information and our human information being fundamentally the same. This was enforced on seeing the completed human genome sequence at the Wellcome Collection and instantly created a comparison with binary code within my mind. I ran with this idea a little and decided to find out more about what a genome is and what binary code is:

The genome is a set of genetic instructions within one cell. The human genome is comprised of 23 pairs of chromosomes which are found in the nucleus as well as a small chromosome found in the mitochondria. Together these chromosomes contain around 3.1 billion bases of DNA sequence. Each of the letters that make up the books within the Wellcome Collection represents one nucleotide base in its natural progression A – adenine , c – cytosine, G – guanine, T – thymine, n – so-called "junk DNA" (large areas, that do not encode to proteins).

Binary code is a device used to represent text or computer processor instructions by using the two-binary digits 1 and 0. This is achieved by assigning each bit string a symbol or instruction.

With this information I can start to play around with the idea of converting the two different types of coding. For example if I take the SRY gene from the Y chromosome the nucleotide sequence is:

ATGCAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGA
ATATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGA
AACGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGG
TCTCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGC
TGGGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACA
GGCCATGCACAGAGAGAAATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAG
AATTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGT
ACAGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAA
CGCAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAG

But then I can convert this into binary code where it becomes:

01000001 01010100 01000111 01000011 01000001 01000001 01010100 01000011 01000001 01010100 01000001 01010100 01000111 01000011 01010100 01010100 01000011 01010100 01000111 01000011 01010100 01000001 01010100 01000111 01010100 01010100 01000001 01000001 01000111 01000011 01000111 01010100 01000001 01010100 01010100 01000011 01000001 01000001 01000011 01000001 01000111 01000011 01000111 01000001 01010100 01000111 01000001 01010100 01010100 01000001 01000011 01000001 01000111 01010100 01000011 01000011 01000001 01000111 01000011 01010100 01000111 01010100 01000111 01000011 01000001 01000001 01000111 01000001 01000111 01000001 00001010 01000001 01010100 01000001 01010100 01010100 01000011 01000011 01000011 01000111 01000011 01010100 01000011 01010100 01000011 01000011 01000111 01000111 01000001 01000111 01000001 01000001 01000111 01000011 01010100 01000011 01010100 01010100 01000011 01000011 01010100 01010100 01000011 01000011 01010100 01010100 01010100 01000111 01000011 01000001 01000011 01010100 01000111 01000001 01000001 01000001 01000111 01000011 01010100 01000111 01010100 01000001 01000001 01000011 01010100 01000011 01010100 01000001 01000001 01000111 01010100 01000001 01010100 01000011 01000001 01000111 01010100 01000111 01010100 01000111 01000001 00001010 01000001 01000001 01000011 01000111 01000111 01000111 01000001 01000111 01000001 01000001 01000001 01000001 01000011 01000001 01000111 01010100 01000001 01000001 01000001 01000111 01000111 01000011 01000001 01000001 01000011 01000111 01010100 01000011 01000011 01000001 01000111 01000111 01000001 01010100 01000001 01000111 01000001 01000111 01010100 01000111 01000001 01000001 01000111 01000011 01000111 01000001 01000011 01000011 01000011 01000001 01010100 01000111 01000001 01000001 01000011 01000111 01000011 01000001 01010100 01010100 01000011 01000001 01010100 01000011 01000111 01010100 01000111 01010100 01000111 01000111 00001010 01010100 01000011 01010100 01000011 01000111 01000011 01000111 01000001 01010100 01000011 01000001 01000111 01000001 01000111 01000111 01000011 01000111 01000011 01000001 01000001 01000111 01000001 01010100 01000111 01000111 01000011 01010100 01000011 01010100 01000001 01000111 01000001 01000111 01000001 01000001 01010100 01000011 01000011 01000011 01000001 01000111 01000001 01000001 01010100 01000111 01000011 01000111 01000001 01000001 01000001 01000011 01010100 01000011 01000001 01000111 01000001 01000111 01000001 01010100 01000011 01000001 01000111 01000011 01000001 01000001 01000111 01000011 01000001 01000111 01000011 00001010 01010100 01000111 01000111 01000111 01000001 01010100 01000001 01000011 01000011 01000001 01000111 01010100 01000111 01000111 01000001 01000001 01000001 01000001 01010100 01000111 01000011 01010100 01010100 01000001 01000011 01010100 01000111 01000001 01000001 01000111 01000011 01000011 01000111 01000001 01000001 01000001 01000001 01000001 01010100 01000111 01000111 01000011 01000011 01000001 01010100 01010100 01000011 01010100 01010100 01000011 01000011 01000001 01000111 01000111 01000001 01000111 01000111 01000011 01000001 01000011 01000001 01000111 01000001 01000001 01000001 01010100 01010100 01000001 01000011 01000001 00001010 01000111 01000111 01000011 01000011 01000001 01010100 01000111 01000011 01000001 01000011 01000001 01000111 01000001 01000111 01000001 01000111 01000001 01000001 01000001 01010100 01000001 01000011 01000011 01000011 01000111 01000001 01000001 01010100 01010100 01000001 01010100 01000001 01000001 01000111 01010100 01000001 01010100 01000011 01000111 01000001 01000011 01000011 01010100 01000011 01000111 01010100 01000011 01000111 01000111 01000001 01000001 01000111 01000111 01000011 01000111 01000001 01000001 01000111 01000001 01010100 01000111 01000011 01010100 01000111 01000011 01000011 01000111 01000001 01000001 01000111 00001010 01000001 01000001 01010100 01010100 01000111 01000011 01000001 01000111 01010100 01010100 01010100 01000111 01000011 01010100 01010100 01000011 01000011 01000011 01000111 01000011 01000001 01000111 01000001 01010100 01000011 01000011 01000011 01000111 01000011 01010100 01010100 01000011 01000111 01000111 01010100 01000001 01000011 01010100 01000011 01010100 01000111 01000011 01000001 01000111 01000011 01000111 01000001 01000001 01000111 01010100 01000111 01000011 01000001 01000001 01000011 01010100 01000111 01000111 01000001 01000011 01000001 01000001 01000011 01000001 01000111 01000111 01010100 01010100 01000111 01010100 00001010 01000001 01000011 01000001 01000111 01000111 01000111 01000001 01010100 01000111 01000001 01000011 01010100 01000111 01010100 01000001 01000011 01000111 01000001 01000001 01000001 01000111 01000011 01000011 01000001 01000011 01000001 01000011 01000001 01000011 01010100 01000011 01000001 01000001 01000111 01000001 01000001 01010100 01000111 01000111 01000001 01000111 01000011 01000001 01000011 01000011 01000001 01000111 01000011 01010100 01000001 01000111 01000111 01000011 01000011 01000001 01000011 01010100 01010100 01000001 01000011 01000011 01000111 01000011 01000011 01000011 01000001 01010100 01000011 01000001 01000001 00001010 01000011 01000111 01000011 01000001 01000111 01000011 01000011 01000001 01000111 01000011 01010100 01000011 01000001 01000011 01000011 01000111 01000011 01000001 01000111 01000011 01000001 01000001 01000011 01000111 01000111 01000111 01000001 01000011 01000011 01000111 01000011 01010100 01000001 01000011 01000001 01000111 01000011 01000011 01000001 01000011 01010100 01000111 01000111 01000001 01000011 01000001 01000001 01000001 01000111 01000011 01010100 01000111 01010100 01000001 01000111